May 2021 3 120 Report
How to write mRNA sequence?

This is the base sequence from one strand of DNA

TACAAGGTCCCTGAGATAGGATACTTTCCGATACGG

write the mRNA sequence which would be transcribed, complementary to this DNA strand

thanks for any help, I cant remember how to do this :/

Please enter comments
Please enter your name.
Please enter the correct email address.
You must agree before submitting.

Answers & Comments


Helpful Social

Copyright © 2024 Q2A.ES - All rights reserved.